• SIREs Version: 3.0
Go back

HERE ARE YOUR RESULTS

Job ID: ad68ada6-6700 | You submitted 12 sequence/s | We found 14 IRE/s in 8 different sequence/s

Bookmark this URL to come back to the results. We will store them for 7 days.

⚠ THIS IS A PREDICTION. Experimental validation using EMSA is needed.

Click on the header of the table to sort by that field ? ?

Seq. ID Start End Loop Type Mismatches 3' Bulge N25 GU/UG Pred. Loop Pred. Pairs Pred. C8 Free Energy Quality Location dCAP-5'IRE d5'IRE-AUG dTER-3'IRE
NM_000032.5... 8 39 1.0 - - A 1.0 -7.0 High 5'UTR 22 30 -
NM_00112814... 3238 3269 2.0 - - A 0.0 -6.9 High 3'UTR - - 899
NM_00112814... 3288 3319 1.0 - - A 0.0 -8.4 High 3'UTR - - 949
NM_00112814... 3692 3723 1.0 - - A 1.0 -9.8 High 3'UTR - - 1353
NM_00112814... 3757 3788 1.0 - - A 0.0 -9.0 High 3'UTR - - 1419
NM_00112814... 3804 3835 1.0 - - A 0.0 -11.7 High 3'UTR - - 1465
NM_00128605... 2569 2600 5.0 N11-N22:A_A - G 1.0 -2.0 Medium-Low 3'UTR - - 1642
NM_00128605... 6312 6344 8.0 - N21b:G G 0.0 -0.5 Medium-Low 3'UTR - - 5385
NM_010239.2... 86 117 1.0 - - C 0.0 -7.2 High 5'UTR 100 125 -
NM_016917.2... 101 132 1.0 - - A 0.0 -10.8 High 5'UTR 116 216 -
NM_020686.6... 4088 4120 19.0 - N21b:T G 1.0 -1.7 Medium 3'UTR - - 2465
NM_025137.4... 6458 6489 18.0 N11-N22:C_A - A 1.0 -4.5 Medium-Low CDS - - -
NM_181460.4... 2272 2303 7.0 N07-N25:G_G - G 1.0 -2.7 Low 3'UTR - - 680
NM_181460.4... 2272 2304 7.0 - N22b:A C 2.0 -1.2 Medium 3'UTR - - 681
Download list in GFF format ?

NM_000032.5_ALAS2

Sequence Context

Position in sequence: 8-39

     1        ACCTGTCATTCGTTCGTCCTCAGTGCAGGGCAACAGGACTTTAGGTTCAAGAT      53     54 GGTGACTGCAGCCATGCTGCTACAGTGCTGCCCAGTGCTTGCCCGGGGCCCCACAAGCCT     113    114 CCTAGGCAAGGTGGTTAAGACTCACCAGTTCCTGTTTGGTATTGGACGCTGTCCCATCCT     173



Download in FASTA format ?

  • Quality : High

    Global Score : 7.5/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • 1.0 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -7.0 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_001128148.3_TFRC

Sequence Context

Position in sequence: 3238-3269

  3104 AGAACCAGTTTCAGGTGTTTAGTTGCAGACTCAGTTTGTCAGACTTTAAAGAATAATATG    3163   3164 CTGCCAAATTTTGGCCAAAGTGTTAATCTTAGGGGAGAGCTTTCTGTCCTTTTGGCACTG    3223   3224 AGATATTTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATGGTGTTTTTTTAATAG    3283   3284 AATATAATTATCGGAAGCAGTGCCTTCCATAATTATGACAGTTATACTGTCGGTTTTTTT    3343   3344 TAAATAAAAGCAGCATCTGCTAATAAAACCCAACAGATACTGGAAGTTTTGCATTTATGG    3403



Download in FASTA format ?

  • Quality : High

    Global Score : 8/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 2.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -6.9 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_001128148.3_TFRC

Sequence Context

Position in sequence: 3288-3319

  3154 GAATAATATGCTGCCAAATTTTGGCCAAAGTGTTAATCTTAGGGGAGAGCTTTCTGTCCT    3213   3214 TTTGGCACTGAGATATTTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATGGTGTT    3273   3274 TTTTTAATAGAATATAATTATCGGAAGCAGTGCCTTCCATAATTATGACAGTTATACTGT    3333   3334 CGGTTTTTTTTAAATAAAAGCAGCATCTGCTAATAAAACCCAACAGATACTGGAAGTTTT    3393   3394 GCATTTATGGTCAACACTTAAGGGTTTTAGAAAACAGCCGTCAGCCAAATGTAATTGAAT    3453



Download in FASTA format ?

  • Quality : High

    Global Score : 8/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -8.4 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_001128148.3_TFRC

Sequence Context

Position in sequence: 3692-3723

  3558 GTGACCAAGTTATAAATCAATGTCACTTAAAGGCTGTGGTAGTACTCCTGCAAAATTTTA    3617   3618 TAGCTCAGTTTATCCAAGGTGTAACTCTAATTCCCATTTTGCAAAATTTCCAGTACCTTT    3677   3678 GTCACAATCCTAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAAAGAACAAGGTA    3737   3738 GTTTTTACCTACCACAGTGTCTGTATCGGAGACAGTGATCTCCATATGTTACACTAAGGG    3797   3798 TGTAAGTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGACATCTTCAA    3857



Download in FASTA format ?

  • Quality : High

    Global Score : 7.5/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • 1.0 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -9.8 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_001128148.3_TFRC

Sequence Context

Position in sequence: 3757-3788

  3623 CAGTTTATCCAAGGTGTAACTCTAATTCCCATTTTGCAAAATTTCCAGTACCTTTGTCAC    3682   3683 AATCCTAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAAAGAACAAGGTAGTTTT    3742   3743 TACCTACCACAGTGTCTGTATCGGAGACAGTGATCTCCATATGTTACACTAAGGGTGTAA    3802   3803 GTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGACATCTTCAAAGCTT    3862   3863 GAAGATCGTTAGTATCTAACATGTATCCCAACTCCTATAATTCCCTATCTTTTAGTTTTA    3922



Download in FASTA format ?

  • Quality : High

    Global Score : 8/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -9.0 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_001128148.3_TFRC

Sequence Context

Position in sequence: 3804-3835

  3670 GTACCTTTGTCACAATCCTAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAAAGA    3729   3730 ACAAGGTAGTTTTTACCTACCACAGTGTCTGTATCGGAGACAGTGATCTCCATATGTTAC    3789   3790 ACTAAGGGTGTAAGTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGAC    3849   3850 ATCTTCAAAGCTTGAAGATCGTTAGTATCTAACATGTATCCCAACTCCTATAATTCCCTA    3909   3910 TCTTTTAGTTTTAGTTGCAGAAACATTTTGTGGTCATTAAGCATTGGGTGGGTAAATTCA    3969



Download in FASTA format ?

  • Quality : High

    Global Score : 8/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -11.7 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_001286050.2

Sequence Context

Position in sequence: 2569-2600

  2435 AGAAATTGCAAATGAAGAAATAGCATTTGGAAATTCTGTGAAGACATCTGGAACTTCCGT    2494   2495 CCTGTACCTGACTCCACCTCCAGGAGAAGGAGCAGGTGGACTGGCCGAAAAGGAGAGGCC    2554   2555 ATGCTTTTAGGACAGTAGCCCCTCATCCCGAGAGGAGAGGAAGAGGAGGAAGACAGTGGG    2614   2615 AGTCATCAGGAGAGGAGAATGAGGATGAGGCCCAGGAGACAGGCTCATCTGGGAGAAGAG    2674   2675 GGACCCCTGGGACGAGGAGGTCCCTGCTAGTCTCAGCCAGGAGCCTGGATTGCCCAGCAG    2734



Download in FASTA format ?

  • Quality : Medium-Low

    Global Score : 4.0/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • This loop type was derived from SELEX Experiments. Motif class: 5.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • One Mismatch

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 IS a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • 1.0 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop does NOT match the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is NOT present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -2.0 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_001286050.2

Sequence Context

Position in sequence: 6312-6344

  6178 ACCCCAGCAAGACCAGCATCTCCAGACCCCAGCCTTTCTCCTCAGGCCTAAGAGAGTCAG    6237   6238 GGAAAGAGAGGAGACTGTCCCAGAGACCTTCTCCTCGGGTCAGCCAGATAGTCTGGATCT    6297   6298 ATGGTGTGACTCAAGCTCCTCCTTACCCAGGGGGGGTAAGGCCAGGCCTCTAGCTACTTG    6357   6358 GAGTTGTCTGTAATAATCTTGAAAGGCCCAAGGGCCTGTCCCCATCCTGACTTAAAGGCA    6417   6418 TCTGCTTCCCTGTTTCATATCACATGACAGAGAAACCTGTTCTCATGGCATGTAACATCC    6477



Download in FASTA format ?

  • Quality : Medium-Low

    Global Score : 4/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • This loop type was derived from SELEX Experiments. Motif class: 8.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • 3' Bulge at position 21b

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 IS a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop does NOT match the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem do NOT match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is NOT present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -0.5 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_010239.2_Fth1

Sequence Context

Position in sequence: 86-117

     1                                                  AGCGCTCGCCT      11     12 GACGCAGGATCCCGCTATAAGTGCGGCCCGCTGTCCCCTCCTGCGCCAGACGTTCTCGCC      71     72 CAGAGTCGCCGCGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCT     131    132 CCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCC     191    192 AGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTG     251



Download in FASTA format ?

  • Quality : High

    Global Score : 8/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -7.2 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_016917.2_Slc40a1

Sequence Context

Position in sequence: 101-132

     1                                   GCCCGCGGCGGTGGCGGCGGCGGCGG      26     27 CGGCGGCGAGAGCAGGCTCGGGGTCTCCTGCGGCCGGTGGATCCTCCAACCCGCTCCCAT      86     87 AAGGCTTTGGCTTTCCAACTTCAGCTACAGTGTTAGCTAAGTTTGGAAAGAAGACAAAAA     146    147 GAAGACCCCGTGACAGCTTTGCTGTTGTTGTTTGCCTTAGTTGTCCTTTGGGGTCTTTCG     206    207 GCATAAGGCTGTTGTGCTTATACTGGTGCTATCTTCGGTTCCTCTCACTCCTGTGAACAA     266



Download in FASTA format ?

  • Quality : High

    Global Score : 8/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • Loop is of the canonical type. Motif class: 1.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • No GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -10.8 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_020686.6

Sequence Context

Position in sequence: 4088-4120

  3954 TTAAGCCAGGGCACAACCAGAAAAGTGGCTCTCTTTGGTAGGGAGAGGGGCTCCAATATT    4013   4014 TCGTTCTCTCCCCATGGGGCACTGACAGAGAAATGAAATAGTTTTATCTGGAAAATTCCA    4073   4074 GAGCTATTATTTACTCCTTACCAAGGGAAGTTACTTCTTGTAAAAACTTTTAAGCCATTT    4133   4134 ATCAACAAGTTCTTGTTGACTCAGGGCATAATGAGTTCCTGAGACATGCTCTTTTGGGGG    4193   4194 CTGGGGCTTTAGCTAGAAGAATTTCAAGGAAAAGAATTCTCAGCAGAGCTCAAGATTGTA    4253



Download in FASTA format ?

  • Quality : Medium

    Global Score : 4.5/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • This loop type was derived from SELEX Experiments. Motif class: 19.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • 3' Bulge at position 21b

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 IS a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • 1.0 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop does NOT match the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem do NOT match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -1.7 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_025137.4

Sequence Context

Position in sequence: 6458-6489

  6324 GATTTCCTCCGTTCCCCATGGGGAACTGTCTTGCACCACAGAGCTCCTGATCCTGGCCCA    6383   6384 TCATTGCTTCACCCTGACGTGCCACATGGAGGGCATCATCCGAGTCCTACAGGCCGCCCA    6443   6444 CATGCTCACAGATAACCACCTGGCCCCCAGTGAGGAGTATGGGCTGGTGGTACGGCTCCT    6503   6504 CACTGGCATTGGAAGGTACAACGAGATGACATACATATTTGATTTGCTGCATAAAAAGCA    6563   6564 CTACTTTGAAGTGCTAATGAGGAAGAAGTTGGATCCGAGTGGTACCCTGAAAACAGCCCT    6623



Download in FASTA format ?

  • Quality : Medium-Low

    Global Score : 4.0/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • This loop type was derived from SELEX Experiments. Motif class: 18.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • One Mismatch

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • 1.0 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop does NOT match the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem do NOT match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is NOT present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -4.5 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_181460.4

Sequence Context

Position in sequence: 2272-2303

  2138 GTGGGGAGAGGTGTGTGACGTTTTTCCAGTTCACATTTATTTGGTAGCCCACCTGGGTTG    2197   2198 GAGGAAGGGCACGGTGGAGAGAAAGTGACATGCATTCACATATCTGCTTATCAGTGTGCA    2257   2258 ATACTGTGTACCTCATGGATGCTTTGGCAATGCCCAAGGCGATATAAGCAAAATCAGAAG    2317   2318 TATATTTTTGCAGGTGCTTTTATTTTCACAGCCCATAATTCATAGTGATAGAGTGCAGTG    2377   2378 ATGTTTGCCATTTGCTGGACAACCAACACCCGGGTTGCTCCTTTGATTAGAGACCAGATC    2437



Download in FASTA format ?

  • Quality : Low

    Global Score : 2.0/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • This loop type was derived from SELEX Experiments. Motif class: 7.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • N07-N25 Mismatch

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • No 3' Bulges

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 IS a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • 1.0 GU Pair

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is NOT present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -2.7 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top

NM_181460.4

Sequence Context

Position in sequence: 2272-2304

  2138 GTGGGGAGAGGTGTGTGACGTTTTTCCAGTTCACATTTATTTGGTAGCCCACCTGGGTTG    2197   2198 GAGGAAGGGCACGGTGGAGAGAAAGTGACATGCATTCACATATCTGCTTATCAGTGTGCA    2257   2258 ATACTGTGTACCTCATGGATGCTTTGGCAATGCCCAAGGCGATATAAGCAAAATCAGAAG    2317   2318 TATATTTTTGCAGGTGCTTTTATTTTCACAGCCCATAATTCATAGTGATAGAGTGCAGTG    2377   2378 ATGTTTGCCATTTGCTGGACAACCAACACCCGGGTTGCTCCTTTGATTAGAGACCAGATC    2437



Download in FASTA format ?

  • Quality : Medium

    Global Score : 5.0/8

    • 8 6 H
    4 M
    < 0 L
    THIS IRE
    7.36
    5.5


  • Energy

    • -7.11
    -11.7
    -2.8
    THIS IRE



Predictions

Download as an image or in Vienna format ?
Download as an image or in Vienna format ?

Report Click on the features to learn what they mean

  • SIREs Prediction

  • This loop type was derived from SELEX Experiments. Motif class: 7.0

    HELP: Motif type
    There are 18 types of motives. Motifs 1 and 2 are the canonical ones, while 3 to 18 are derived from SELEX experiments. Motif 19 is a novel motif that has been experimentally validated. Please look at the "Docs Pages" to know more Close

  • No Mismatches

    HELP: Mismatch
    We allow one, but only one mistmatch in the stem. The presence of a mismatch and a bulge (see the Bulge help) are incompatible Close

  • 3' Bulge at position 22b

    HELP: 3' Bulge
    An unpaired base (a "Bulge") is allowed at positions 20b, 21b,22b or 23b. The presence of a mismatch (see the mismatches help) and a buldge are incompatible Close

  • n25 is not a G

    HELP: The 25th base
    A G Residue in this position could compromise the IRE stability since it could pair with the C8, which needs to be free to interact with the Iron Regulatory proteins (IRPs). Close

  • 2.0 GU Pairs

    HELP: GU/UG Pairings
    GU/UG parings are possible in RNA strands. However, experiments suggest that only 2 of those can be present in the IRE stem for it to be stable. Close

  • SIREs Prediction vs. RNAFold Prediction

  • Loop matches the RNAFold prediction

    HELP: Predicted Loop
    The 6 nucleotide apical loop also folds as a loop in the RNAFold prediction. Close

  • Pairings in the upper stem do NOT match the RNAFold prediction

    HELP: Predicted Pairings
    The base pairings in the upper stem predicted by SIREs are also pairing in the RNAFold prediction. Close

  • C8 Bulge is NOT present in the RNAFold prediction

    HELP: C8 in the predicted folding
    The C8 bulge predicted by SIREs is also predicted in the RNAFold structure as an unpair nucleotide. Nucleotide at position 8 (C8 bulge) is an important contact site with the IRPs. Close

  • Free Energy

  • Free Energy: -1.2 kcal/mol

    HELP:Minimum Free Energy
    Minimum Free Energy of the folded RNA structure has been calculated with the Vienna Package. Please visit Vienna package Site for further information. Close

Top



Download all files from this job


Go back